Mature sequence mdo-miR-7

Accession numberMIMAT0004086
IDmdo-miR-7
Stem-Loop mdo-mir-7
Sequence
uggaagacuagugauuuuguug
Get sequence
Deep sequencing3617 reads, 5 experiments
Predicted targets

References

1