Mature sequence mdo-miR-137a

Accession numberMIMAT0004110
IDmdo-miR-137a
Stem-Loop mdo-mir-137a
Sequence
uauugcuuaagaauacgcguag
Get sequence
Deep sequencing74114 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1