Mature sequence mdo-miR-204

Accession numberMIMAT0004127
IDmdo-miR-204
Stem-Loop mdo-mir-204
Sequence
uucccuuugucauccuaugccu
Get sequence
Deep sequencing4257 reads, 5 experiments
Predicted targets

References

1