Mature sequence mdo-miR-206

Accession numberMIMAT0004128
IDmdo-miR-206
Stem-Loop mdo-mir-206
Sequence
uggaauguaaggaagugugug
Get sequence
Deep sequencing118948 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1