Mature sequence mdo-miR-375

Accession numberMIMAT0004138
IDmdo-miR-375
Stem-Loop mdo-mir-375
Sequence
uuuuguucguucggcucgcguga
Get sequence
Deep sequencing3931 reads, 5 experiments
Predicted targets

References

1