Mature sequence mdo-miR-25

Accession numberMIMAT0004179
IDmdo-miR-25
Stem-Loop mdo-mir-25
Sequence
cauugcacuugucucggucuga
Get sequence
Deep sequencing10940 reads, 5 experiments
Predicted targets

References

1