Mature sequence bta-miR-195

Accession numberMIMAT0004335
IDbta-miR-195
Stem-Loop bta-mir-195
Sequence
uagcagcacagaaauauuggca
Get sequence
Deep sequencing25445 reads, 66 experiments
Predicted targets

References

1