Mature sequence bta-miR-99b

Accession numberMIMAT0004345
IDbta-miR-99b
Stem-Loop bta-mir-99b
Sequence
cacccguagaaccgaccuugcg
Get sequence
Deep sequencing120120 reads, 77 experiments
Predicted targets

References

1