Mature sequence hiv1-miR-N367

Accession numberMIMAT0004478
IDhiv1-miR-N367
Stem-Loop hiv1-mir-N367
Sequence
acugaccuuuggauggugcuucaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15601474 "HIV-1 nef suppression by virally encoded microRNA" Omoto S, Ito M, Tsutsumi Y, Ichikawa Y, Okuyama H, Brisibe EA, Saksena NK, Fujii YR Retrovirology. 1:44(2004).
2
PMID:15722536 "Regulation of human immunodeficiency virus 1 transcription by nef microRNA" Omoto S, Fujii YR J Gen Virol. 86:751-755(2005).
3
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
4