Mature sequence hiv1-miR-H1

• Accession number: MIMAT0004480
• ID: hiv1-miR-H1
• Stem-Loop: hiv1-mir-H1
• Sequence: ccagggaggcgugccugggc
• Deep sequencing: reads, experiments

References

1. "Evidence and nature of a novel miRNA encoded by HIV-1" Kaul D, Khanna A and Suman Proc Indian Natn Sci Acad. 72:91-95(2006).
2. PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3. PMID:17855543 "Analysis of the interaction of primate retroviruses with the human RNA interference machinery" Lin J, Cullen BR J Virol. 81:12218-12226(2007).
4. PMID:19082544 "HIV-1 genome-encoded hiv1-mir-H1 impairs cellular responses to infection" Kaul D, Ahlawat A, Gupta SD Mol Cell Biochem. 323:143-148(2009).
5. PMID:20546828 "HIV-miR-H1 evolvability during HIV pathogenesis" Lamers SL, Fogel GB, McGrath MS Biosystems. 101:88-96(2010).