Accession | MIMAT0004550 |
Description | hsa-miR-30c-2-3p mature miRNA |
Hairpins | |
Sequence | CUGGGAGAAGGCUGUUUACUCU |
Evidence |
experimental
cloned [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | has_input UniProtKB:P24864 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | has_input UniProtKB:Q15628 |
involved_in | GO:0008285 negative regulation of cell population proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | has_input UniProtKB:P14780 |
involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | has_input UniProtKB:P24864 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | has_input UniProtKB:Q15628 |
involved_in | GO:0043124 negative regulation of canonical NF-kappaB signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | |
involved_in | GO:0071356 cellular response to tumor necrosis factor |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 | |
involved_in | GO:2000134 negative regulation of G1/S transition of mitotic cell cycle |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25732226 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|