MIR30C2 is a gene that encodes a microRNA called miR-30c-2 [PMC9708458]. The TonE consensus sequence TGGAAANNYNY, which is regulated by TonEBP, was identified in the regulatory regions of the murine mir324 and MIR30C2 genes [PMC9104010]. The lncRNA LINC00472 includes both the MIR30A and MIR30C2 genes, suggesting that it may be the primary transcript for miR-30a and miR-30c [PMC9512191]. In cases with a miR-30c cluster deletion, MIR30C1 on 1p34.2 was deleted in 2 out of 5 cases, while MIR30C2 on 6q13 was deleted in 4 out of 5 cases [PMC5400605]. The loss rate for MIR30C1 was found to be 88%, while for MIR30C2 it was 32% in samples with a miR-30c cluster deletion [PMC5400605]. In lung adenocarcinoma (LUAD), the expression of COPZ1 was negatively correlated with several microRNAs including MIR221, MIR23A, MIR3677, and MIRLET7D [PMC10137353]. A substitution located in the 10th nucleotide of mature miR-30c-2-5p (n.16C>A) was identified in the sequence of MIR3OC2 [PMC9708458]. NONO interacts with several microRNAs including MIR148B, MIRC93, and MIRO148A as well as protein-coding genes and other non-coding RNAs [PMC9730017]. Frequent amplifications were observed in the genes encoding hsa-mir-30c, MIR30C1, and MIR30C2, and significant changes in the levels of hsa-mir-30c were found in many patients [PMC4129468].
uacU U ACA guggaa aga GUAAACA CCU CUCUCAGCu a ||| ||||||| ||| ||||||||| ucu CAUUUGU GGA GAGGGUCga g uUCU C --A aagaau
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000244 |
Description | Homo sapiens hsa-miR-30c-5p mature miRNA |
Sequence | 7 - UGUAAACAUCCUACACUCUCAGC - 29 |
Evidence |
experimental
cloned [2,4-6] |
Database links | |
Predicted targets |
Accession | MIMAT0004550 |
Description | Homo sapiens hsa-miR-30c-2-3p mature miRNA |
Sequence | 47 - CUGGGAGAAGGCUGUUUACUCU - 68 |
Evidence |
experimental
cloned [5] |
Database links | |
Predicted targets |
|