MIR30C2 is a gene encoding a microRNA involved in regulatory processes, located on chromosome 6q13 [PMC5400605]. It is part of the miR-30c cluster, which has been observed to undergo deletions in various cases of genomic alterations, with MIR30C2 specifically being deleted in 32% (13 out of 41) of the samples studied [PMC5400605]. The regulatory potential of MIR30C2 has been highlighted by the identification of a TonE consensus sequence by Jaspar software, suggesting that TonEBP may influence its expression [PMC9104010]. Additionally, MIR30C2 is encompassed within the sequence of LINC00472, indicating that this long non-coding RNA could serve as the primary transcript for miR-30c [PMC9512191]. The gene has also been associated with negative correlations with COPZ1 expression in lung adenocarcinoma (LUAD) and interacts with various RNA and protein molecules as identified through research on NONO protein interactions [PMC10137353; PMC9730017].. Furthermore, a single nucleotide polymorphism (SNP) within MIR30C2 has been identified which could potentially impact its function [PMC9708458]. These findings underscore the significance of MIR30C2 in genomic stability and its potential role in gene regulation.
uacU U ACA guggaa aga GUAAACA CCU CUCUCAGCu a ||| ||||||| ||| ||||||||| ucu CAUUUGU GGA GAGGGUCga g uUCU C --A aagaau
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000244 |
| Description | Homo sapiens hsa-miR-30c-5p mature miRNA |
| Sequence | 7 - UGUAAACAUCCUACACUCUCAGC - 29 |
| Evidence |
experimental
cloned [2,4-6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004550 |
| Description | Homo sapiens hsa-miR-30c-2-3p mature miRNA |
| Sequence | 47 - CUGGGAGAAGGCUGUUUACUCU - 68 |
| Evidence |
experimental
cloned [5] |
| Database links |
|
| Predicted targets |
|
|