miRBase entry: hsa-mir-30c-2

Stem-loop hsa-mir-30c-2


Accession
MI0000254
Symbol
HGNC: MIR30C2
Description
Homo sapiens hsa-mir-30c-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR30C2 is a gene that encodes a microRNA called miR-30c-2 [PMC9708458]. The TonE consensus sequence TGGAAANNYNY, which is regulated by TonEBP, was identified in the regulatory regions of the murine mir324 and MIR30C2 genes [PMC9104010]. The lncRNA LINC00472 includes both the MIR30A and MIR30C2 genes, suggesting that it may be the primary transcript for miR-30a and miR-30c [PMC9512191]. In cases with a miR-30c cluster deletion, MIR30C1 on 1p34.2 was deleted in 2 out of 5 cases, while MIR30C2 on 6q13 was deleted in 4 out of 5 cases [PMC5400605]. The loss rate for MIR30C1 was found to be 88%, while for MIR30C2 it was 32% in samples with a miR-30c cluster deletion [PMC5400605]. In lung adenocarcinoma (LUAD), the expression of COPZ1 was negatively correlated with several microRNAs including MIR221, MIR23A, MIR3677, and MIRLET7D [PMC10137353]. A substitution located in the 10th nucleotide of mature miR-30c-2-5p (n.16C>A) was identified in the sequence of MIR3OC2 [PMC9708458]. NONO interacts with several microRNAs including MIR148B, MIRC93, and MIRO148A as well as protein-coding genes and other non-coding RNAs [PMC9730017]. Frequent amplifications were observed in the genes encoding hsa-mir-30c, MIR30C1, and MIR30C2, and significant changes in the levels of hsa-mir-30c were found in many patients [PMC4129468].

Literature search
381 open access papers mention hsa-mir-30c-2
(1903 sentences)

Sequence

298038 reads, 1554 reads per million, 158 experiments
agauacUGUAAACAUCCUACACUCUCAGCuguggaaaguaagaaagCUGGGAGAAGGCUGUUUACUCUuucu
(((....(((((((.(((...(((((((((..............))))))))).))).)))))))....)))

Structure
   uacU       U   ACA         guggaa 
aga    GUAAACA CCU   CUCUCAGCu      a
|||    ||||||| |||   |||||||||       
ucu    CAUUUGU GGA   GAGGGUCga      g
   uUCU       C   --A         aagaau 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MIR:MI0000736) and 6 (MIR:MI0000254) [3]. Expression of miR-30c was later independently verified in human HL-60 leukemia cells [2].

Genome context
chr6: 71376960-71377031 [-]

Disease association
hsa-mir-30c-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-30c-5p

Accession MIMAT0000244
Description Homo sapiens hsa-miR-30c-5p mature miRNA
Sequence 7 - UGUAAACAUCCUACACUCUCAGC - 29
Evidence experimental
cloned [2,4-6]
Database links
Predicted targets

Mature hsa-miR-30c-2-3p

Accession MIMAT0004550
Description Homo sapiens hsa-miR-30c-2-3p mature miRNA
Sequence 47 - CUGGGAGAAGGCUGUUUACUCU - 68
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73