miRBase entry: hsa-mir-30c-2

Stem-loop hsa-mir-30c-2


Accession
MI0000254
Symbol
HGNC: MIR30C2
Description
Homo sapiens hsa-mir-30c-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR30C2 is a gene encoding a microRNA involved in regulatory processes, located on chromosome 6q13 [PMC5400605]. It is part of the miR-30c cluster, which has been observed to undergo deletions in various cases of genomic alterations, with MIR30C2 specifically being deleted in 32% (13 out of 41) of the samples studied [PMC5400605]. The regulatory potential of MIR30C2 has been highlighted by the identification of a TonE consensus sequence by Jaspar software, suggesting that TonEBP may influence its expression [PMC9104010]. Additionally, MIR30C2 is encompassed within the sequence of LINC00472, indicating that this long non-coding RNA could serve as the primary transcript for miR-30c [PMC9512191]. The gene has also been associated with negative correlations with COPZ1 expression in lung adenocarcinoma (LUAD) and interacts with various RNA and protein molecules as identified through research on NONO protein interactions [PMC10137353; PMC9730017].. Furthermore, a single nucleotide polymorphism (SNP) within MIR30C2 has been identified which could potentially impact its function [PMC9708458]. These findings underscore the significance of MIR30C2 in genomic stability and its potential role in gene regulation.

Literature search
381 open access papers mention hsa-mir-30c-2
(1903 sentences)

Sequence

298037 reads, 1054 reads per million, 158 experiments
agauacUGUAAACAUCCUACACUCUCAGCuguggaaaguaagaaagCUGGGAGAAGGCUGUUUACUCUuucu
(((....(((((((.(((...(((((((((..............))))))))).))).)))))))....)))

Structure
   uacU       U   ACA         guggaa 
aga    GUAAACA CCU   CUCUCAGCu      a
|||    ||||||| |||   |||||||||       
ucu    CAUUUGU GGA   GAGGGUCga      g
   uUCU       C   --A         aagaau 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MIR:MI0000736) and 6 (MIR:MI0000254) [3]. Expression of miR-30c was later independently verified in human HL-60 leukemia cells [2].

Genome context
chr6: 71376960-71377031 [-]

Disease association
hsa-mir-30c-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-30c-5p

Accession MIMAT0000244
Description Homo sapiens hsa-miR-30c-5p mature miRNA
Sequence 7 - UGUAAACAUCCUACACUCUCAGC - 29
Evidence experimental
cloned [2,4-6]
Database links
Predicted targets

Mature hsa-miR-30c-2-3p

Accession MIMAT0004550
Description Homo sapiens hsa-miR-30c-2-3p mature miRNA
Sequence 47 - CUGGGAGAAGGCUGUUUACUCU - 68
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73