Mature hsa-miR-214-5p
| Accession | MIMAT0004564 |
| Description | hsa-miR-214-5p mature miRNA |
| Hairpins | |
| Sequence | UGCCUGUCUACACUUGCUGUGC |
| Evidence |
experimental
cloned [2-3], Northern [3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:1903243 negative regulation of cardiac muscle hypertrophy in response to stress |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:27162619 | occurs_in UBERON:0003101 |
| involved_in | GO:1904707 positive regulation of vascular associated smooth muscle cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28684904 | occurs_in UBERON:0002012 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
