MIR214 is a microRNA that has been implicated in the process of endothelial injury when induced by oxidized low-density lipoprotein (oxLDL) [PMC9199460]. It is suggested that the inhibition of MIR214, among other microRNAs, might confer protective effects against such endothelial damage [PMC9199460]. Additionally, MIR214 is located in a novel genomic region identified as 1q24.3, which has been associated with gene-based genome-wide significant signals [PMC5458088]. This region also includes DNM3OS and MIR3120, indicating a potential cluster of functionally related genes that could be relevant to endothelial function or pathology [PMC5458088].
ggccu acaga u ACA aacau
ggcugg guugucaugug cUGCCUGUCU CUUGCUGUGCag c
|||||| ||||||||||| |||||||||| |||||||||||| c
ccgacc caacaguacac GACGGACAGA GGACGACAuguc g
----u ----- U CAC cacuc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004564 |
| Description | Homo sapiens hsa-miR-214-5p mature miRNA |
| Sequence | 30 - UGCCUGUCUACACUUGCUGUGC - 51 |
| Evidence |
experimental
cloned [2-3], Northern [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000271 |
| Description | Homo sapiens hsa-miR-214-3p mature miRNA |
| Sequence | 71 - ACAGCAGGCACAGACAGGCAGU - 92 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|