miRBase entry: hsa-mir-214

Stem-loop hsa-mir-214


Accession
MI0000290
Symbol
HGNC: MIR214
Description
Homo sapiens hsa-mir-214 precursor miRNA mir-214
Gene
family?
RF00660; mir-214

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR214 is a microRNA that has been implicated in the process of endothelial injury when induced by oxidized low-density lipoprotein (oxLDL) [PMC9199460]. It is suggested that the inhibition of MIR214, among other microRNAs, might confer protective effects against such endothelial damage [PMC9199460]. Additionally, MIR214 is located in a novel genomic region identified as 1q24.3, which has been associated with gene-based genome-wide significant signals [PMC5458088]. This region also includes DNM3OS and MIR3120, indicating a potential cluster of functionally related genes that could be relevant to endothelial function or pathology [PMC5458088].

Literature search
289 open access papers mention hsa-mir-214
(2846 sentences)

Sequence

57984 reads, 306 reads per million, 102 experiments
ggccuggcuggacagaguugucaugugucUGCCUGUCUACACUUGCUGUGCagaacauccgcucaccuguACAGCAGGCACAGACAGGCAGUcacaugacaacccagccu
.....((((((.....(((((((((((.((((((((((...((((((((((((.............))))))))))))...)))))))))).))))))))))))))))).

Structure
ggccu      acaga           u          ACA            aacau 
     ggcugg     guugucaugug cUGCCUGUCU   CUUGCUGUGCag     c
     ||||||     ||||||||||| ||||||||||   ||||||||||||     c
     ccgacc     caacaguacac GACGGACAGA   GGACGACAuguc     g
----u      -----           U          CAC            cacuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr1: 172138798-172138907 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-214
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-214 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-214 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-214 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-214-5p

Accession MIMAT0004564
Description Homo sapiens hsa-miR-214-5p mature miRNA
Sequence 30 - UGCCUGUCUACACUUGCUGUGC - 51
Evidence experimental
cloned [2-3], Northern [3]
Database links
Predicted targets

Mature hsa-miR-214-3p

Accession MIMAT0000271
Description Homo sapiens hsa-miR-214-3p mature miRNA
Sequence 71 - ACAGCAGGCACAGACAGGCAGU - 92
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52