Mature hsa-miR-135a-3p
| Accession | MIMAT0004595 |
| Description | hsa-miR-135a-3p mature miRNA |
| Hairpins | |
| Sequence | UAUAGGGAUUGGAGCCGUGGCG |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29734196 | has_input UniProtKB:Q16552 |
| involved_in | GO:0032700 negative regulation of interleukin-17 production |
ECO:0000305 curator inference used in manual assertion |
PMID:29734196 | has_input UniProtKB:Q16552 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29734196 | has_input UniProtKB:Q16552 |
| involved_in | GO:0150152 negative regulation of interleukin-17A production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29734196 | |
| involved_in | GO:1900016 negative regulation of cytokine production involved in inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29734196 | occurs_in CL:1001573 |
| involved_in | GO:1903882 negative regulation of interleukin-17-mediated signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29734196 | occurs_in CL:1001573 |
| located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |
