Accession | MIMAT0004604 |
Description | hsa-miR-127-5p mature miRNA |
Hairpins | |
Sequence | CUGAAGCUCAGAGGGCUCUGAU |
Evidence |
experimental
cloned [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:2000752 regulation of glucosylceramide catabolic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25584808 | occurs_in CL:0000057 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25584808 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25584808 | has_input UniProtKB:Q14108 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25584808 |