WARNING: This summary was generated by AI. MIR127 is a microRNA encoded by RTL1as and functions as a repressor for RTL1 expression through the RNAi mechanism, as observed in the interaction between mouse Rtl1 and Rtl1as [PMC3469456]. This microRNA, particularly miR-127-3p, is implicated in the regulation of inflammatory responses, targeting IgG FcγRI (CD64) and modulating cytokine release by macrophages during lung inflammation [PMC5247697].
u --c guc a u G G C -- a gugau acu ucc gcc gCU AAGCUCAGA GG UCUGAU uc g ||||| ||| ||| ||| ||| ||||||||| || |||||| || a uacua uga agg ugg CGG UUCGAGUCU CC AGGCUa ag a c cuc --- c U - G U cu a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004604 |
| Description | Homo sapiens hsa-miR-127-5p mature miRNA |
| Sequence | 23 - CUGAAGCUCAGAGGGCUCUGAU - 44 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000446 |
| Description | Homo sapiens hsa-miR-127-3p mature miRNA |
| Sequence | 57 - UCGGAUCCGUCUGAGCUUGGCU - 78 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|