Stem-loop hsa-mir-127

Accession

MI0000472

Symbol

HGNC: MIR127

Description

Homo sapiens hsa-mir-127 precursor miRNA mir-127

Gene
family

RF00676; mir-127

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR127 is a microRNA that functions as a repressor for RTL1 expression through the RNAi mechanism [PMC3469456]. The expression of RTL1 is significantly elevated in mice with the targeted deletion of the maternally derived IG-DMR, similar to the elevation observed in mice with increased RTL1 expression due to MIR127 repression [PMC3469456]. The increased expression of RTL1 is attributed to the repressor function of MIR127, which is encoded by RTL1as [PMC3469456]. It has been suggested that MIR127, along with other microRNAs such as miR433, regulates the expression of RTL1 through RNAi mechanism [PMC3469456]. Additionally, it has been proposed that DIO3, a gene involved in thyroid hormone metabolism, may not be solely expressed from the paternally inherited allele and may undergo partial imprinting or complete imprinting escape [PMC3469456]. Furthermore, MIR127 has been found to regulate IL-6 and TNF-α cytokine release by macrophages in lung inflammation by targeting IgG FcγRI (CD64) [PMC5247697]. Overall, MIR127 plays a crucial role in regulating gene expression and cytokine release through its repressor function.

Literature search

154 open access papers mention hsa-mir-127
(925 sentences)

Sequence

110941 reads, 596 reads per million, 103 experiments

ugugaucacugucuccagccugCUGAAGCUCAGAGGGCUCUGAUucagaaagaucaUCGGAUCCGUCUGAGCUUGGCUggucggaagucucaucauc
.(((((.(((...(((.(((.(((.(((((((((.((.((((((((.....))..)))))).)).)))))))))))).))).))))))...))))).

Structure

u     --c   guc   a   u   G         G  C      --  a 
 gugau   acu   ucc gcc gCU AAGCUCAGA GG UCUGAU  uc g
 |||||   |||   ||| ||| ||| ||||||||| || ||||||  || a
 uacua   uga   agg ugg CGG UUCGAGUCU CC AGGCUa  ag a
c     cuc   ---   c   U   -         G  U      cu  a 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed by cloning in human cells [2,3].

Genome context

chr14: 100882979-100883075 [+]

Clustered miRNAs

6 other miRNAs are < 10 kb from hsa-mir-127

Disease association

hsa-mir-127 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-127-5p

• Accession: MIMAT0004604
• Description: Homo sapiens hsa-miR-127-5p mature miRNA
• Sequence: 23 - CUGAAGCUCAGAGGGCUCUGAU - 44
• Evidence: experimental ; cloned [3-4]

Mature hsa-miR-127-3p

• Accession: MIMAT0000446
• Description: Homo sapiens hsa-miR-127-3p mature miRNA
• Sequence: 57 - UCGGAUCCGUCUGAGCUUGGCU - 78
• Evidence: experimental ; cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 18230126
   New miRNAs cloned from neuroblastoma
   "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
   "BMC Genomics (2008) 9:52


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


4. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706