Mature hsa-miR-127-5p
| Accession | MIMAT0004604 |
| Description | hsa-miR-127-5p mature miRNA |
| Hairpins | |
| Sequence | CUGAAGCUCAGAGGGCUCUGAU |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:2000752 regulation of glucosylceramide catabolic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25584808 | occurs_in CL:0000057 fibroblast |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25584808 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25584808 | has_input UniProtKB:Q14108 Lysosome membrane protein 2 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25584808 |
