Accession | MIMAT0004694 |
Description | hsa-miR-342-5p mature miRNA |
Hairpins | |
Sequence | AGGGGUGCUAUCUGUGAUUGA |
Evidence |
experimental
cloned [3-5], Northern [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0045541 negative regulation of cholesterol biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23951060 | |
acts_upstream_of | GO:0045717 negative regulation of fatty acid biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23951060 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23951060 | has_input UniProtKB:P36956 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26857067 | has_input UniProtKB:P17813 |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26857067 | occurs_in CL:0002618 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26857067 | has_input UniProtKB:P17813 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23951060 | has_input UniProtKB:P36956 |
involved_in | GO:0043536 positive regulation of blood vessel endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26857067 | results_in_movement_of CL:0002618 |
involved_in | GO:0062000 positive regulation of cardiac endothelial to mesenchymal transition |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26857067 | |
involved_in | GO:1900747 negative regulation of vascular endothelial growth factor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26857067 | occurs_in CL:0002618 |
involved_in | GO:1903588 negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26857067 | results_in_division_of CL:0002618 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |