WARNING: This summary was generated by AI. MIR342 is a microRNA that plays a role in regulating gene expression within cells [PMC4133867]. In MIR342 (-/-) mice, a decrease in the activation of NPY+pSTAT3+ neurons was observed, alongside an increase in POMC+pSTAT3+ neurons [PMC8437242]. These changes were associated with a decrease in food intake and an improvement in metabolic phenotypes, suggesting that MIR342 may have a role in energy balance and metabolism [PMC8437242]. Additionally, the downregulation of DNA-methyltransferase-1 (DNMT1) and subsequent reactivation of ADAM23 is linked to the restoration of proper MIR342 expression levels [PMC4133867]. This indicates that MIR342 may also be involved in epigenetic regulation through its influence on DNA methylation processes [PMC4133867].
gaaac u G --UA AU g ---- g
ugggc caaggugA GGGUGC UCUGUG UGAgg a cau g
||||| |||||||| |||||| |||||| ||||| | ||| u
auccg guuccacU CCCACG AGACAC ACUCU u gua u
-auuc - G CUAA -- g uaag a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004694 |
| Description | Homo sapiens hsa-miR-342-5p mature miRNA |
| Sequence | 19 - AGGGGUGCUAUCUGUGAUUGA - 39 |
| Evidence |
experimental
cloned [3-5], Northern [5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000753 |
| Description | Homo sapiens hsa-miR-342-3p mature miRNA |
| Sequence | 61 - UCUCACACAGAAAUCGCACCCGU - 83 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
|