MIR342 is a microRNA that plays a role in regulating gene expression within cells [PMC4133867]. In MIR342 (-/-) mice, a decrease in the activation of NPY+pSTAT3+ neurons was observed, alongside an increase in POMC+pSTAT3+ neurons [PMC8437242]. These changes were associated with a decrease in food intake and an improvement in metabolic phenotypes, suggesting that MIR342 may have a role in energy balance and metabolism [PMC8437242]. Additionally, the downregulation of DNA-methyltransferase-1 (DNMT1) and subsequent reactivation of ADAM23 is linked to the restoration of proper MIR342 expression levels [PMC4133867]. This indicates that MIR342 may also be involved in epigenetic regulation through its influence on DNA methylation processes [PMC4133867].
gaaac u G --UA AU g ---- g ugggc caaggugA GGGUGC UCUGUG UGAgg a cau g ||||| |||||||| |||||| |||||| ||||| | ||| u auccg guuccacU CCCACG AGACAC ACUCU u gua u -auuc - G CUAA -- g uaag a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004694 |
Description | Homo sapiens hsa-miR-342-5p mature miRNA |
Sequence | 19 - AGGGGUGCUAUCUGUGAUUGA - 39 |
Evidence |
experimental
cloned [3-5], Northern [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000753 |
Description | Homo sapiens hsa-miR-342-3p mature miRNA |
Sequence | 61 - UCUCACACAGAAAUCGCACCCGU - 83 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|