Mature sequence mmu-miR-509-3p

Accession numberMIMAT0004891
IDmmu-miR-509-3p
Stem-Loop mmu-mir-509
Sequence
ugauugacauuucuguaaugg
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).