Mature sequence mmu-miR-467g

Accession numberMIMAT0005854
IDmmu-miR-467g
Stem-Loop mmu-mir-467g
Sequence
uauacauacacacacauauau
Get sequence
Deep sequencing15852 reads, 107 experiments
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).