Mature sequence hsa-miR-1299

Accession numberMIMAT0005887
IDhsa-miR-1299
Stem-Loop hsa-mir-1299
Sequence
uucuggaauucugugugaggga
Get sequence
Deep sequencing4578 reads, 121 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).