MIR1299 is a novel non-coding RNA (ncRNA) marker that has not been previously associated with any diseases, including cancer [PMC5354851]. This study is the first to report the expression of MIR1299 in ameloblastoma tumors [PMC5354851'>PMC5354851]. In addition to MIR1299, other miRNAs such as miR1256, miR205, miR4454, and miR548X were found to be overexpressed in ameloblastoma tumors [PMC5354851]. Furthermore, MIR1299 was found to be upregulated in both ASD and Non-TD subjects, along with other genes such as IGLV1-40, LRRC37A4P, PMCHL2CHL2, TRBV11-2 [PMC6814108]. In Non-TD subjects specifically, LRRC37AP, MIR1299 PMCHL2 and TRBV11-2 were among the top upregulated genes [PMC6814108'>PMC6814108]. Another study demonstrated the overexpression of MIR1299 in ameloblastomas using microarrays and suggested its potential role in the etiopathogenesis of this tumor [PMC7920560]. Additionally, MIR1299 was identified as one of the top genes depleted in a replicate screen along with FAM32A EIF3I BIRC2 BCL2 [PMC9402397]. Finally, based on NGS data from a previous study, MIR1299 was selected as a target for further miRNA analysis [PMC8744551]. References: - PMC5354851 - PMC6814108 - PMC7920560 - PMC9402397 - PMC8744551
-- ug u ---c a gacaau ccuca gcag guucuggaau cuacgug gg c ||||| |||| |||||||||| ||||||| || GGAGU UGUC UAAGGUCUUg gaugcac cc a AG -G U ugac - agacuu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005887 |
Description | Homo sapiens hsa-miR-1299 mature miRNA |
Sequence | 62 - UUCUGGAAUUCUGUGUGAGGGA - 83 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|