Mature sequence hsa-miR-548p

Accession numberMIMAT0005934
IDhsa-miR-548p
Stem-Loop hsa-mir-548p
Sequence
uagcaaaaacugcaguuacuuu
Get sequence
Deep sequencing3554 reads, 122 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).