Stem-loop hsa-mir-548p

Accession

MI0006420

Symbol

HGNC: MIR548P

Description

Homo sapiens hsa-mir-548p precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR548P is a microRNA that has been found to significantly decrease lipoprotein production and lipid synthesis in hepatocytes. It achieves this by lowering the activity of 3-hydroxy 3-methylglutarylCoA reductase and long-chain acylCoA synthetase ACSL471, which are involved in cholesterol and fatty acid synthesis. However, MIR548P does not affect fatty acid oxidation [PMC7123062]. MIR548P interacts with the 3′-untranslated region of the APOB mRNA, leading to its post-transcriptional degradation and reducing ApoB synthesis and secretion from hepatocytes [PMC7123062]. It has been found that MIR548P reduces ApoB secretion and lipid synthesis through its effects on HMGCoAR and long-chain fatty acylCoA synthase ACSL4 [PMC7123062]. In the context of esophageal squamous cell carcinoma (ESCC), high expression of MIR548P, along with TRAV39, has been associated with a poor prognosis due to the promotion of antitumor immunity [PMC9509226]. Additionally, MIR548P expression was found to be negatively associated with activated mast cells but positively associated with activated T cell CD4 memory cells [PMC9509226]. The expression levels of MIR548P were also found to be correlated with the immune microenvironment in ESCC patients [PMC9509226]. Furthermore, low expression levels of MIR548P were associated with a lower 5-year overall survival rate in ESCC patients [PMC9509226'>PMC9509226]. However, there was no evidence supporting a positive link between the expression of MIR548P and clinicopathological characteristics in ESCC patients [PMC9509226]. Overall, TRAV39 and MIR548P expressions may serve as predictors for clinical outcomes in ESCC patients by reflecting the status of the tumor microenvironment [PMC9509226].

Literature search

42 open access papers mention hsa-mir-548p
(142 sentences)

Sequence

359 reads, 31 reads per million, 49 experiments

auuagguugguauaaaauuaauugcaguuuuugucauuacuuucaaUAGCAAAAACUGCAGUUACUUUugcaccaauguaauac
((((.((((((.(((((.((((((((((((((((.(((......))).)))))))))))))))).))))).)))))).))))..

Structure

--    g      a     u                c   ac 
  auua guuggu uaaaa uaauugcaguuuuugu auu  u
  |||| |||||| ||||| |||||||||||||||| |||   
  uaau uaacca guUUU AUUGACGUCAAAAACG Uaa  u
ca    g      c     C                A   cu 

Annotation confidence Not enough data

Genome context

chr5: 100816482-100816565 [-]

Disease association

hsa-mir-548p is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-548p

• Accession: MIMAT0005934
• Description: Homo sapiens hsa-miR-548p mature miRNA
• Sequence: 47 - UAGCAAAAACUGCAGUUACUUU - 68
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 18285502
   Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
   "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
   "Genome Res (2008) 18:610-621