MIR548P, a microRNA, plays a significant role in lipid metabolism by decreasing lipoprotein production and lipid synthesis in hepatocytes without affecting fatty acid oxidation [PMC7123062]. It achieves this by downregulating the activity of key enzymes such as 3-hydroxy 3-methylglutaryl-CoA reductase and long-chain acyl-CoA synthetase ACSL4, as well as by promoting the degradation of APOB mRNA, which reduces ApoB synthesis and secretion [PMC7123062]. In the context of esophageal squamous cell carcinoma (ESCC), MIR548P is associated with immune system modulation; its expression is inversely related to activated mast cells and positively related to activated CD4 memory T cells [PMC9509226]. However, high levels of MIR548P expression are linked to poor prognosis in ESCC, and this is associated with a decreased overall survival rate [PMC9509226]. The microRNA's expression is also associated with the immune microenvironment within tumors as analyzed by the CIBERSORT algorithm [PMC9509226]. No positive correlation has been established between MIR548P expression and clinicopathological features of ESCC patients [PMC9509226].
-- g a u c ac auua guuggu uaaaa uaauugcaguuuuugu auu u |||| |||||| ||||| |||||||||||||||| ||| uaau uaacca guUUU AUUGACGUCAAAAACG Uaa u ca g c C A cu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005934 |
| Description | Homo sapiens hsa-miR-548p mature miRNA |
| Sequence | 47 - UAGCAAAAACUGCAGUUACUUU - 68 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|