Mature sequence hsa-miR-1282

Accession numberMIMAT0005940
IDhsa-miR-1282
Stem-Loop hsa-mir-1282
Sequence
ucguuugccuuuuucugcuu
Get sequence
Deep sequencing17 reads, 17 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).