Mature sequence mdo-miR-1543

Accession numberMIMAT0006142
IDmdo-miR-1543
Stem-Loop mdo-mir-1543
Sequence
uuaguccuagucuaggugcaca
Get sequence
Deep sequencing336 reads, 2 experiments
Predicted targets

References

1