Mature sequence mml-miR-668

Accession numberMIMAT0006504
IDmml-miR-668
Stem-Loop mml-mir-668
Sequence
ugucacucggcucggcccacuac
Get sequence
Deep sequencing718 reads, 6 experiments
Predicted targets

References

1