Mature sequence vvi-miR399f

Accession numberMIMAT0006567
IDvvi-miR399f
Stem-Loop vvi-MIR399f
Sequence
ugccgaaggagauuuguccug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).