Mature sequence oan-miR-29b-3p

Accession numberMIMAT0006809
IDoan-miR-29b-3p
Previous IDsoan-miR-29b
Stem-Loop oan-mir-29b-1 oan-mir-29b-2
Sequence
uagcaccauuugaaaucagugu
Get sequence
Deep sequencing52661 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).