Mature sequence oan-miR-200a-3p

Accession numberMIMAT0006936
IDoan-miR-200a-3p
Previous IDsoan-miR-200a
Stem-Loop oan-mir-200a
Sequence
uaacacugucugguaacgauguu
Get sequence
Deep sequencing11185 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).