Mature sequence oan-miR-194-5p

Accession numberMIMAT0006999
IDoan-miR-194-5p
Previous IDsoan-miR-194
Stem-Loop oan-mir-194-1 oan-mir-194-2
Sequence
uguaacagcaacuccaugugga
Get sequence
Deep sequencing64305 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).