Mature sequence gga-miR-1684a-3p

Accession numberMIMAT0007572
IDgga-miR-1684a-3p
Previous IDsgga-miR-1684
Stem-Loop gga-mir-1684a
Sequence
aaguaugaggaaauggagcucu
Get sequence
Deep sequencing3333 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).