Mature sequence gga-miR-1736-5p

Accession numberMIMAT0007638
IDgga-miR-1736-5p
Previous IDsgga-miR-1736*
Stem-Loop gga-mir-1736
Sequence
agggcaauuccugauaggugcu
Get sequence
Deep sequencing14 reads, 4 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).