Mature sequence gga-miR-1769-5p

Accession numberMIMAT0007677
IDgga-miR-1769-5p
Previous IDsgga-miR-1769*
Stem-Loop gga-mir-1769
Sequence
cuucaggcuuuucucacaccug
Get sequence
Deep sequencing7 reads, 3 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).