Mature sequence ssc-miR-221-3p

• Accession number: MIMAT0007762
• ID: ssc-miR-221-3p
• Previous IDs: ssc-miR-221
• Stem-Loop: ssc-mir-221
• Sequence: agcuacauugucugcuggguuu
• Deep sequencing: 15254 reads, 15 experiments

References

1. PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
2. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).