Mature sequence hsa-miR-1911-5p

Accession numberMIMAT0007885
IDhsa-miR-1911-5p
Previous IDshsa-miR-1911
Stem-Loop hsa-mir-1911
Sequence
ugaguaccgccaugucuguuggg
Get sequence
Deep sequencing924 reads, 52 experiments
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).