Mature sequence bmo-miR-13a-5p

• Accession number: MIMAT0007896
• ID: bmo-miR-13a-5p
• Previous IDs: bmo-miR-13a*
• Stem-Loop: bmo-mir-13a
• Sequence: ccugucaaagcggcggugaaa
• Deep sequencing: 2 reads, 1 experiments

References

1. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).