Mature sequence bmo-miR-13a-3p

• Accession number: MIMAT0007897
• ID: bmo-miR-13a-3p
• Previous IDs: bmo-miR-13a
• Stem-Loop: bmo-mir-13a
• Sequence: uaucacagccacuuugaugug
• Deep sequencing: 112 reads, 3 experiments
• Database links:
  • RNAcentral:URS00003902CD_7091

References

1. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).