Mature sequence bmo-miR-79-3p

Accession numberMIMAT0007899
IDbmo-miR-79-3p
Previous IDsbmo-miR-79
Stem-Loop bmo-mir-79
Sequence
uucauaaagcuagauuaccaaagcau
Get sequence
Deep sequencing4394 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).