Mature sequence bmo-miR-317-3p

Accession numberMIMAT0007906
IDbmo-miR-317-3p
Previous IDsbmo-miR-317
Stem-Loop bmo-mir-317
Sequence
agugaacacagcuggugguauc
Get sequence
Deep sequencing11784 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).