Mature sequence bmo-bantam-3p

Accession numberMIMAT0007907
IDbmo-bantam-3p
Previous IDsbmo-bantam
Stem-Loop bmo-bantam
Sequence
ugagaucauugugaaagcuaauu
Get sequence
Deep sequencing13541 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).