Mature sequence bmo-bantam-3p

• Accession number: MIMAT0007907
• ID: bmo-bantam-3p
• Previous IDs: bmo-bantam
• Stem-Loop: bmo-bantam
• Sequence: ugagaucauugugaaagcuaauu
• Deep sequencing: 13541 reads, 3 experiments
• Database links:
  • RNAcentral:URS00003B421B_7091

References

1. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2. PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
3. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).