Mature sequence ptr-miR-1302

Accession numberMIMAT0008021
IDptr-miR-1302
Stem-Loop ptr-mir-1302-1 ptr-mir-1302-2 ptr-mir-1302-3 ptr-mir-1302-4 ptr-mir-1302-5 ptr-mir-1302-6 ptr-mir-1302-7 ptr-mir-1302-8
Sequence
uugggacauacuuaugcuaaa
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).