Mature sequence sly-miR399

Accession numberMIMAT0009146
IDsly-miR399
Stem-Loop sly-MIR399
Sequence
ugccaaaggagaguugcccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).