Mature sequence bmo-miR-12

Accession numberMIMAT0009151
IDbmo-miR-12
Stem-Loop bmo-mir-12
Sequence
ugaguauuacuucagguacuggu
Get sequence
Deep sequencing7900 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).