Mature sequence bmo-miR-278-3p

Accession numberMIMAT0009164
IDbmo-miR-278-3p
Previous IDsbmo-miR-278
Stem-Loop bmo-mir-278
Sequence
ucggugggaucuucguccguuu
Get sequence
Deep sequencing8792 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).