Mature sequence bta-miR-502b

Accession numberMIMAT0009339
IDbta-miR-502b
Stem-Loop bta-mir-502b
Sequence
aauccaccugggcaaggauuc
Get sequence
Deep sequencing12942 reads, 77 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).