Mature sequence hsa-miR-1976

Accession numberMIMAT0009451
IDhsa-miR-1976
Stem-Loop hsa-mir-1976
Sequence
ccuccugcccuccuugcugu
Get sequence
Deep sequencing120 reads, 40 experiments
Predicted targets

References

1
PMID:18923441 "Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia" Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH, Broekhuis MJ, Peters TC, Pieters R, den Boer ML Leukemia. 23:313-322(2009).