Mature sequence bta-miR-1271

Accession numberMIMAT0009975
IDbta-miR-1271
Stem-Loop bta-mir-1271
Sequence
cuuggcaccuaguaaguacuca
Get sequence
Deep sequencing1883 reads, 68 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).